The presence of white spots in the kidneys of cattle at slaughter (so-called white-spotted kidneys) can be an indication of infection with Leptospira, a spirochaete
of public health concern because it causes zoonotic disease. In this study, 24 kidneys of 180 slaughtered cows (13.3%) showed focal to multifocal white spots at inspection.
These kidneys, together with matching urine (n = 18) and blood (n = 24) samples, were examined by polymerase chain reaction (PCR) targeting the LipL32
gene. Leptospiral deoxyribonucleic acid (DNA) was detected in 19 (79.2%) out of 24 kidneys, as well as 7 (29.2%) blood and 10 (55.5%) urine samples of cows with white spots
in their kidneys. Histopathological findings revealed multifocal infiltration of mononuclear cells, including lymphocytes and a few plasma cells in the renal interstitial
tissues. In addition, 14 apparently normal kidneys and associated urine and blood samples were similarly examined by PCR but did not provide any positive results. In this
study, high detection of leptospirosis in kidneys with interstitial nephritis suggests that Leptospira spp. are associated with white spotted kidneys. The present
findings indicate that white spotted kidneys can be due to leptospirosis in this region in southwestern Iran, which indicates an increased risk of zoonotic disease. The
data show that LipL32-based primers are useful for PCR-based diagnosis of leptospirosis.
Leptospirosis is an acute febrile and septicaemic disease caused by spirochaetes of the family Leptospiraceae, which includes saprophytic and pathogenic bacteria.
Pathogenic leptospires are important in public health because they cause zoonotic disease (Bharti et al. 2003; Hernández-Rodríguez et al. 2011;
Levett 2001; McBride et al. 2005). A wide range of host species, including humans, wildlife including rodents and carnivores, and domestic animals, act as reservoirs
for Leptospira (Jorge et al. 2011; Liu et al. 2006). Humans may be affected after direct contact with infected urine or more often indirectly
via exposure to water or soil contaminated by the urine of infected animals (Tansuphasiri et al. 2006; Vijayachari, Sugunan & Shriram 2008).
After leptospiraemia in the host, the kidneys are the main tissue for localisation of the organism and the chronic lesion of the disease is focal chronic interstitial
nephritis (FCIN) (Yang, Wu & Pan 2001), known as white-spotted kidneys. This lesion is a common finding in clinically healthy cattle at slaughter (Maxie 1993;
Uzal et al. 2002). Although several pathogens can cause white spots in kidneys, FCIN is frequently attributed to current or previous leptospiral infection by
veterinarians in the abattoir (Uzal et al. 2002). Clinical signs and necropsy findings of leptospirosis are not pathognomonic and may be mistaken for those
produced by other pathogens. Therefore, clinical diagnosis alone is not sufficient and must be accompanied by complementary tests in order to achieve precise diagnostic
results and design proper disease control strategies (Agudelo-Florez, Restrepo & Lotero 2006; Gumussoy et al. 2009).
In domestic animals such as cattle, leptospirosis causes septicaemia, icterus, anaemia and haemoglobinuria and is responsible for serious economic losses, especially in
the meat and dairy industry, due to abortion, mastitis and a decline in milk production (Quinn et al. 2002). The kidney and genital organs are the main target
tissues in infected cattle. Infected cattle may not show any clinical signs of disease, but excrete the organisms in their urine. Cattle therefore play an important role
in spreading the infection to other susceptible animals and to human populations at risk, such as farmers and veterinarians (Levett 2001; Mineiro et al. 2011). The
aim of this study was to determine the correlation between white-spotted kidneys with leptospirosis in cattle at an abattoir, using the polymerase chain reaction (PCR)
technique. The urine and blood samples of the cattle with lesions in the kidneys were also examined for evidence of Leptospira spp.
Study area
Chaharmahalva Bakhtiary province is an historic and beautiful area in southwestern Iran. The province has an area of 16 533 km2, situated at the centre of
the Zagros mountains, between latitudes 31º, 4′ S and 42º, 4′ N and longitudes 49º, 39′ W and 51º, 21′ E. The rainfall in the
province is derived mostly from Mediterranean and Sudanese atmospheric flows from the west and south that affect the region for 8 months (from October to May). The weather
in winter is rather cold and minimum temperatures may reach −20 ºC. The average rainfall of the province is about 560 mm.
Sample collection
The kidneys of 180 slaughtered cows 1–4 years old were grossly examined for white-spotted kidneys from December 2010 to March 2011 at Shahrekord abattoir. The animals
were slaughtered for human consumption. The kidneys of 24 cows (13.3%) showed macroscopic, focal to multifocal white spots at inspection. Samples of these kidneys were
taken for pathological and PCR investigations. At the same time, urine samples were collected directly during slaughter from the urinary bladder with a sterile needle.
Before slaughter, blood was collected into tubes containing anticoagulant and correlated with the carcass number in the slaughter line. To obtain the buffy coat, blood
samples were centrifuged at 10000 x g for 10 minutes and the buffy coat was kept in 1.5 mL microtubes. Subsequently, all kidney, urine and buffy coat samples were
stored at −20 °C until examination. In addition, samples of kidney, urine and blood were similarly taken from 14 cattle with no gross lesions in their
kidneys as a control group.
Polymerase chain reaction
Deoxyribonucleic acid (DNA) was extracted from frozen kidneys, buffy coat and urine samples with a high yield DNA purification kit (Cinnagen Inc, PN811SC, Iran), according
to the manufacturer's instructions. Polymerase chain reaction based on the LipL32 gene was performed using the primers 5’ATCTCCGTTGCACTCTTTGC3’,
5’ACCATCATCATCATCGTCCA3’ as previously described by Tansuphasiri et al. (2006). This set of primers was designed to distinguish between pathogenic
and saprophytic Leptospira species, because the LipL32 gene is amplified only in pathogenic species (Tansuphasiri et al. 2006).
Polymerase chain reaction amplification was performed using the following programme: an initial cycle of denaturation at 94 ºC for 3 min, 30 cycles of
denaturation at 94 ºC for 1 min, annealing at 60 ºC for 90 s, extension at 72 ºC for 20 min, and a final extension at
72 ºC for 10 min and holding at 4 ºC. The amplified products were analysed by electrophoresis on ethidium bromide-stained 2% agarose gels
and the results were observed using Ultraviolet (UV) light. A sample was considered positive when the 474 bp DNA band was obtained (Vital-Brazil et al.
2010).
Histopathological investigation
Tissue samples of kidneys 1 cm3 thick were fixed in 10% neutral buffered formalin for histopathological examination. The samples were then dehydrated in
graded ethanol and embedded in paraffin. Sections 5 μm thick were stained with haematoxylin and eosin and examined with an ordinary light microscope.
Ethical considerations
The study was approved by the local ethics committee of our faculty, in accordance with the ethics standards of ‘Principles of Laboratory Animal Care’.
Polymerase Chain Reaction
In the present study, the results of a PCR method targeting the LipL32 gene on DNA extracted from kidneys with white spots, urine and buffy coat samples are shown in
Table 1. Leptospiral DNA was detected in 19 out of 24 kidneys (79.2%) with focal to multifocal white spots, whilst most animals were serologically negative for
Leptospira spp. by the PCR technique. Only 7 of 24 buffy coat samples (29.2%) were positive by PCR. Out of 18 urine samples from the cows with white spots in their
kidneys, 10 (55.5%) were PCR positive (Figure 1). Amplicons of the expected size were not detected in kidney, urine or buffy coat samples from 14 cows with apparently
normal kidneys.
|
FIGURE 1:
Detection of Leptospira deoxyribonucleic acid in kidney tissue of a
cow by polymerase chain reaction-based LipL32 gene.
|
|
TABLE 1:
Detection of leptospiral deoxyribonucleic acid using LipL32-based polymerase chain reaction in blood, urine and kidney tissues of cattle with normal kidney and
white-spotted kidneys.
|
Gross and histopathological findings
Grossly, the kidneys examined showed pale, focal to multifocal spots between 1 mm and 5 mm diameter that were randomly distributed on the surface of kidneys and
demarcated from adjacent tissues. On cut section, these spots formed pale wedges in the cortex with their bases under the renal capsule. Histopathologically, focal
aggregation of mononuclear cells especially lymphocytes and a few plasma cells were visible in the renal interstitial tissue. The cortex was the area most affected,
followed by the cortico-medullary junction. Mononuclear cells were also infiltrated around the glomeruli.
The investigators who undertook the gross observations, histopathological and molecular studies and analysis in the present study were unaware of the experimental design
and grouping details. The histopathological studies were blindly undertaken by three different pathologists.
More than 240 serovars of leptospires are recognised, comprising 23 serogroups (Collins 2006). The clinical signs of the disease are nonspecific and it is frequently lethal
in endemic countries. Therefore, diagnosis of leptospirosis is important for early treatment of infected hosts and a better prognosis and the development of a sensitive
confirmatory diagnostic technique for Leptospira are required (Hernández-Rodríguez et al. 2011). Humans can be infected during occupational
and social activities. People who contribute to maintenance and transportation of animals and their products such as meat, milk and hides may be exposed to the disease
(Orrego, De León & Rios 2003). This makes leptospirosis a significant concern for human health (Levett 2001). Outbreaks of human leptospirosis are reported
from some countries such as India (John 1996), Japan (Nakamura et al. 2006) and Brazil (McBride et al. 2005). Leptospires infect the proximal renal
tubules of various mammals and are excreted in the urine. Cattle are maintenance hosts for some serovars of leptospirosis and are of importance in transmission of the
infection to humans because they excrete live Leptospira spp. in their urine for prolonged periods (Levett 2001). In the abattoir, the macroscopic lesions of
bovine leptospirosis consist of multifocal white spots in the renal parenchyma. These lesions reflect non-suppurative multifocal interstitial nephritis, which is commonly
found in the kidneys of cows infected by leptospires (Wang et al. 1999; Yang et al. 2001) but they are not pathognomonic for leptospirosis because the same
lesion occurs in the kidneys of cows infected by septicaemic colibacillosis (Barker, Van Dreumel & Palmer 1993), salmonellosis or brucellosis (Maxie 1993) and
malignant catarrhal fever (McGavin & Zachary 2007). Affected kidneys are not suitable for human consumption and are condemned during meat inspection (Anon 1997).
In the present study, a PCR technique targeting LipL32 was used for detection of Leptospira in bovine kidney, urine and blood samples. Polymerase chain reaction
is a rapid, sensitive, inexpensive assay and can identify low doses of bacteria (Céspedes et al. 2007). This technique is useful for diagnosis of
fastidious and slow-growing organisms, and can be used easily even in non-specialised laboratories compared with an older test, MAT, which is expensive and needs a special
laboratory (Céspedes et al.2007; Hernández-Rodríguez et al. 2011). Procedures based on nucleic acid detection appear to be reliable for
differentiation of pathogenic from nonpathogenic Leptospira species (Brenner et al. 1999; Maxie 1993). Hernández-Rodríguez et al.
(2011) investigated bovine leptospirosis with PCR, culture and dark field microscopy and reported that PCR is a reliable, rapid and accurate technique for diagnosis of
leptospirosis.
The primer used in the current study was based on the LipL32 gene. This gene is a major outer membrane protein that is found on the surface of all
pathogenic Leptospira spp. and has been highly conserved amongst these species (Guerreiro et al. 2001; Haake et al. 2000; Stoddard et al. 2009).
The amplification of the LipL32 gene has proved to be a valuable tool for identifying pathogenic leptospires in water samples (Vital-Brazil et al. 2010).
Cheema et al. (2007) used PCR based on LipL21 and LipL32 genes for detection of pathogenic Leptospira in the serum and tissue samples of
cattle and buffaloes and found that both genes are useful for diagnosis of leptospirosis. Jouglard et al. (2006) evaluated a PCR method for detection of
Leptospira spp. Applied primers were designed to amplify a 264 bp region within the LipL32 gene that is absent in
nonpathogenic Leptospira species. The sensitivity and specificity were assessed using 7 and 37 saprophytic and pathogenic serovars respectively and 15
other microorganisms. They described this method as very specific for identification of pathogenic serovars.
In this study, the level of detection of leptospiral DNA in kidneys with interstitial nephritis suggests that Leptospira spp. are associated with white-spotted
kidneys in this area. In a similar study, Mineiro et al. (2011) investigated possible leptospiral infection in the sera of 60 slaughtered cows by MAT, and 23
(38.3%) positive samples were obtained. The kidneys of 20 serologically positive cows were examined histopathologically. All of them (100%) showed multifocal interstitial
nephritis (Mineiro et al. 2011). Yener and Keles (2001) studied 68 white-spotted and 30 apparently normal kidneys in slaughtered cows for detection of
Leptospira using histopathology and immunohistochemistry. Leptospira interrogans antigen was found in 21 of 68 white-spotted kidneys and 4 of 30 grossly
normal kidneys. Grégoire, Higgins and Robinson (1987) studied 955 beef cattle at an abattoir in Quebec, of which 122 kidneys (13%) revealed focal interstitial
nephritis. Nephritic kidneys were cultured for leptospirosis, and matching blood samples were examined serologically. Leptospires were isolated from 35 (29%) of the
kidneys, and 29 (24%) and 13 (10%) cattle were serologically positive for antibodies to L. interrogans serovars hardjo and pomona respectively.
Dorjee et al. (2009) found a significant association between white-spotted kidneys and sheep that were serologically positive for Leptospira by
MAT.
In contrast to the present study, Uzal et al. (2002) evaluated the correlation between white-spotted kidneys and leptospirosis and other infective pathogens in
slaughtered cows in Australia by MAT and culture methods. They isolated Leptospira borgpeterseni hardjo from a urine sample in an adult cow, urine and kidney of
another cow and 6 serum samples of cows with white spots in their kidneys, and concluded that Leptospira spp. are not associated with white-spotted kidneys.
Skilbeck, Forsyth and Dohnt (1988) isolated L. interrogans serovar hardjo from 18 (8.3%) out of 218 bovine kidneys in Australia. Histopathological lesions
related to leptospirosis were not observed in any of the infected kidneys. Leptospires were identified by immunogold silver staining in only two of the kidneys
(Skilbeck et al. 1988).
In this study, 29.2% of cows with lesions in their kidneys were serologically positive by PCR. Polymerase chain reaction can be diagnostic in the leptospiraemic phase
before antibodies are detectible in the serum. When antibodies appear in the blood, leptospires are eliminated from the serum and localised in the kidneys. The organisms
have a tendency to localise in kidneys when the acute phase comes to an end (Oliveira et al. 2005). .In this study, some urine samples of cows with
positive kidneys were negative by PCR because the excretion of leptospires in the urine may be intermittent or continuous (Faine et al. 1999). Demonstration of
leptospires in the kidney or urine when obvious clinical signs are not observed is diagnostic for chronic infection (Ellis 1999).
Since Leptospira bacteria can be present in a wide variety of environments, a rapid and specific diagnostic technique is essential for detecting them and
distinguishing pathogenic from nonpathogenic Leptospira species. This will greatly assist in the application of suitable prevention and control strategies
and improvement of epidemiological studies to protect humans, especially those at the risk of infection. The present data indicate that LipL32-based primers
are useful for diagnosis of leptospirosis and that white-spotted kidneys can be due to leptospirosis in this region of Iran. This is of importance in public health
and indicates a significantly increased risk of zoonotic disease, therefore veterinarians and abattoir workers in charge of meat processing should be aware of the
potential risks associated with leptospirosis (Orrego et al. 2003).
Limitations of the study
In this study, there were limitations that prevented identification of the serovars that resulted in positive samples, but in another study in this geographic area
Jafari Dehkordi, Shahbazkia and Ronagh (2011) identified pathogenic serovars of L. interrogans in 200 (100 urine and 100 blood) samples of dairy cattle by PCR.
Their results showed that 28% of urine and 23% of plasma samples were positive. The main serovars identified were icterohaemorrhagiae (50%) and pomona (37.5%).
The urine samples of 17 serologically negative cows were positive for Leptospira. They proposed that these dairy cows were reservoirs and could transmit infection to
humans (Jafari Dehkordi et al. 2011). Ebrahimi, Nasr and Kojouri (2004) identified grippotyphosa (21.33%), hardjo (17.33%),
icterohaemorrhagiae (6.66%) and pomona (4%) from 400 serum samples of dairy cattle by MAT.
Recommendations
The results of this study can be used to provide recommendations for veterinarians and workers in slaughterhouses to be more aware of the transmission of leptospirosis and
its risks for humans. More research is needed to identify different leptospiral serovars in cows and other ruminants. Also, it is necessary for different molecular and
other techniques to be compared to find a reliable, inexpensive and accessible method for serovar identification.
From this investigation, it can be concluded that economic losses due to leptospirosis, including marketing and export restrictions, decrease in weight of infected animals,
stillbirths, infertility, abortion and loss of milk production due to mastitis are considerable in this geographic situation and should be given more attention. Although
leptospirosis is more prevalent in tropical and subtropical areas (Ramadass & Marshall 1990), this study shows that it can also occur in highland areas with a cold
climate.
The authors would like to thank the Research Council of Islamic Azad University, Shahrekord Branch for their financial support and cooperation.
Competing interests
The authors declare that they have no conflict of interest and financial disclosure to anybody or any organisations.
Authors’ contributions
S.A. (Islamic Azad University) was the project leader and designer, and pathologist, E.T. (Islamic Azad University) and for molecular technique, M.R.H. (Islamic Azad
University), M.G.V. (Islamic Azad University) and H.S. (Islamic Azad University) were responsible for collecting the samples and doing some experiments, and also, A.O.
(Shiraz University) did pathologic studies.
Agudelo-Florez, P., Restrepo, M. & Lotero, M.A., 2006, ‘Evaluation of indirect immunofluorescence assay for diagnosis of human leptospirosis’,
Biomédica 26, 216–223. PMid:16925094
Anon, 1997, Australian export meat manual, Australian Quarantine and Inspection Service, Canberra. Barker, I.K., Van Dreumel, A.A. & Palmer, N., 1993, ‘The alimentary system’, in K.F. Jubb, P.C.N. Kennedy & N. Palmer (eds.), Pathology of
domestic animals, 4th edn., pp. 1–318, Academic Press, San Diego. Bharti, A.R., Nally, J.E., Ricaldi, J.N., Matthias, M.A., Diaz, M.M., Lovett, M.A. et al., on behalf of Peru-United States Leptospirosis Consortium,
2003, ‘Leptospirosis: A zoonotic disease of global importance’, Lancet Infectious Diseases 3, 757–771.
http://dx.doi.org/10.1016/S1473-3099(03)00830-2 Brenner, D.J., Kaufmann, A.F., Sulzer, K.R., Steigerwalt, A.G., Rogers, F.C. & Weyant, R.S., 1999, ‘Further determination of DNA relatedness between
serogroups and serovars in the family Leptospiraceae with a proposal for Leptospira alexanderi sp. nov., and four
new Leptospira genomospecies’, International Journal of Systematic Bacteriology 2, 839–858.
http://dx.doi.org/10.1099/00207713-49-2-839, PMid:10319510
Céspedes, M., Tapia, R., Balda, L., Gonzalez, D., Peralta, C. & Condori, P., 2007, ‘Standardization and validation of the polymerase chain
reaction for early diagnosis of human leptospirosis’, Revista Peruana de Medicina Experimental y Salud Pública 24, 20–26. Cheema, P.S., Srivastava, S.K., Amutha, R., Singh, S., Singh, H. & Sandey, M., 2007, ‘Detection of pathogenic leptospires in animals by PCR
based on LipL21 and LipL32 genes’, Indian Journal of Experimental Biology 45, 568–573.
PMid:17585694 Collins, R.A., 2006, ‘Leptospirosis’, Biomedical Science 2, 116–121. Dorjee, S., Heuer, C., Jackson, R., West, D.M., Collins-Emerson, J.M., Midwinter, A.C. et al., 2009, ‘Are white-spot lesions in kidneys
in sheep associated with leptospirosis?’, New Zealand Veterinary Journal 57, 28–33.
http://dx.doi.org/10.1080/00480169.2009.36865, PMid:19252540
Ebrahimi, A., Nasr, Z. & Kojouri, G.A., 2004, ‘Seroinvestigation of bovine leptospirosis in Shahrekord district, central Iran’, Iranian
Journal of Veterinary Research 4, 370–371. Ellis, W.A., 1999, ‘Leptospirosis’, in B.E. Straw, S. D’Allaire, W.L. Mengeling & D.J. Taylor (eds.), Diseases of swine,
8th edn., pp. 483–493, Iowa State University Press, Ames. Faine, S., Adler, B., Bolin, C. & Perolat, P., 1999, Leptospira and leptospirosis, 2nd edn., MedSci, Melbourne. Grégoire, N., Higgins, R. & Robinson, Y., 1987, ‘Isolation of leptospires from nephritic kidneys of beef cattle at slaughter’,
American Journal of Veterinary Research 48, 1172–1173. PMid:3631705 Guerreiro, H., Croda, J., Flannery, B., Mazel, M., Matsunaga, J., Galvão Reis, M. et al., 2001, ‘Leptospiral proteins recognized
during the humoral immune response to leptospirosis in humans’, Infection and Immunity 69, 4958–4968.
http://dx.doi.org/10.1128/IAI.69.8.4958-4968.2001, PMid:11447174
Gumussoy, K.S., Ozdemir, V., Aydin, F., Aslan, O., Atabek, E., Ica, T. et al., 2009, ‘Seroprevalence of bovine leptospirosis in Kayseri, Turkey and
detection of leptospires by polymerase chain reaction’, Journal of Animal and Veterinary Advances 8, 1222–1229. Haake, D.A., Chao, G., Zuerner, R.L., Barnett, J.K., Barnett, D., Mazel, M. et al., 2000, ‘The leptospiral major outer membrane protein LipL32
is a lipoprotein expressed during mammalian infection’, Infection and Immunity 68, 2276–2285.
http://dx.doi.org/10.1128/IAI.68.4.2276-2285.2000, PMid:10722630
Hernández-Rodríguez, P., Díaz, C.A., Dalmau, E.A. & Quintero, G.M., 2011, ‘A comparison between polymerase chain reaction (PCR) and
traditional techniques for the diagnosis of leptospirosis in bovines’, Journal of Microbiological Methods 84, 1–7.
PMid:21047532
Jafari Dehkordi, A., Shahbazkia, H.R. & Ronagh, N., 2011, ‘Evaluation of pathogenic serovars of Leptospira interrogans in dairy cattle herds of
Shahrekord by PCR’, Iranian Journal of Microbiology 3, 135–139. John, T.J., 1996, ‘Emerging and re-emerging bacterial pathogens in India’, Indian Journal of Medical Research 103, 4–18.
PMid:8926026
Jorge, R.S., Ferreira, F., Neto, J.S., Vasconcellos, S. de A., Lima, E. de S., Morais, Z.M. et al., 2011, ‘Exposure of free-ranging wild carnivores,
horses and domestic dogs to Leptospira spp. in the northern Pantanal, Brazil’, Memórias do Instituto Oswaldo Cruz 106, 441–444.
http://dx.doi.org/10.1590/S0074-02762011000400009 Jouglard, S.D., Simionatto, S., Seixas, F.K., Nassi, F.L. & Dellagostin, O.A., 2006, ‘Nested polymerase chain reaction for detection of pathogenic
leptospires’, Canadian Journal of Microbiology 52, 747–752.
http://dx.doi.org/10.1139/w06-027, PMid:16917533
Levett, P.N., 2001, ‘Leptospirosis’, Clinical Microbiology Review 4, 296–326.
http://dx.doi.org/10.1128/CMR.14.2.296-326.2001, PMid:11292640
Liu, D., Lawrence, M.L., Austin, F.W., Ainsworth, A.J. & Pace, L.W., 2006, ‘PCR detection of pathogenic Leptospira genomospecies targeting putative
transcriptional regulator genes’, Canadian Journal of Microbiology 52, 272–277.
http://dx.doi.org/10.1139/W05-120, PMid:16604124
Maxie, M.G., 1993, ‘The urinary system’, in K.F. Jubb, P.C.N. Kennedy & N. Palmer, (eds.), Pathology of domestic animals, 4th edn., pp.
447–538, Academic Press, San Diego. McBride, A.J., Athanazio, D.A., Reis, M.G. & Ko, A.I., 2005, ‘Leptospirosis’, Current Opinion in Infectious Disease 18, 376–386.
http://dx.doi.org/10.1097/01.qco.0000178824.05715.2c, PMid:16148523
McGavin, M.D. & Zachary, J.F., 2007, Pathologic basis of veterinary disease, 4th edn., Mosby-Elsevier, St Louis. Mineiro, A.L.B.B., Vieira, R.J., Costa, É.A., Santos, R.L., Gonçalves, L.M.F, Carvalho, S.M. et al., 2011, ‘Serology, polymerase
chain reaction and histopathology for leptospirosis in samples collected at slaughter from dairy cows of Parnaiba region, state of Piauí, Brazil’,
Pesquisa Veterinária Brasileira 31, 859–866. Nakamura, M., Taira, K., Itokazu, K., Kudaka, J., Asato, R., Kise, T. et al., 2006, ‘Sporadic cases and an outbreak of leptospirosis probably associated
with recreational activities in rivers in the northern part of Okinawa Main Island’, Journal of Veterinary Medical Science 68, 83–85.
http://dx.doi.org/10.1292/jvms.68.83, PMid:16462124
Oliveira, R.C., Freitas, J.C., Silva, F.G., Souza, E.M., Delbem, A.C.B., Alves, L.A. et al., 2005, ‘Diagnóstico laboratorial da leptospirose
em um cã outilizando diferentes técnicas’, Arquivos do Instituto Biológico 72, 111–113. Orrego, A., Giraldo de León, G. & Ríos, B., 2003, ‘Leptospirosis in high risk groups of workers from fifteen piggeries and the central
abattoir in Manizales, Colombia’, Archivos de Medicina Veterinaria 35, 205–213. Quinn, P.J., Markey, B.K., Carter, M.E., Donnelly, W.J. & Leonard, F.C., 2002, Veterinary microbiology and microbial diseases, Blackwell, MPG
Books, Bodmin. Ramadass, P. & Marshall, R.B., 1990, ‘Species differentiation of Leptospira interrogans serovars hardjo strain Hardjobovis
from strain Hardjoprajitno by DNA slot blot hybridisation’, Research in Veterinary Science 49, 194–197.
PMid:2236916
Skilbeck, N.W., Forsyth, W.M. & Dohnt, M., 1988, ‘Bovine leptospirosis: Microbiological and histological findings in cattle at slaughter’,
Australian Veterinary Journal 65, 73–75.
http://dx.doi.org/10.1111/j.1751-0813.1988.tb07362.x, PMid:3401146
Stoddard, R.A., Gee, J.E., Wilkins, P.P., McCaustland, K. & Hoffmaster, A.R., 2009, ‘Detection of pathogenic Leptospira spp. through TaqMan polymerase
chain reaction targeting the LipL32 gene’, Diagnostic Microbiology and Infectious Disease 64, 247–255.
http://dx.doi.org/10.1016/j.diagmicrobio.2009.03.014, PMid:19395218
Tansuphasiri, U., Chanthadee, R., Phulsuksombati, D. & Sangjun, N., 2006, ‘Development of a duplex-polymerase chain reaction for rapid detection of
pathogenic Leptospira’, Southeast Asian Journal of Tropical Medicine and Public Health 37, 297–308.
PMid:17124990
Uzal, F.A., Dobrenov, B., Smythe, L., Norris, M., Dohnt, M., Symonds, M. et al., 2002, ‘A study of ”white spotted kidneys’’ in
cattle’, Veterinary Microbiology 86, 369–375.
http://dx.doi.org/10.1016/S0378-1135%2802%2900021-4
Vijayachari, P., Sugunan, A.P. & Shriram, A.N., 2008, ‘Leptospirosis: An emerging global public health problem’, Journal of Biosciences 33,
557–569. http://dx.doi.org/10.1007/s12038-008-0074-z,
PMid:19208981
Vital-Brazil, J.M., Balassiano, I.T., De Oliveira, F.S., De Souza Costa, A.D., Hillen, L. & Pereira, M.M., 2010, ‘Multiplex PCR-based detection of
Leptospira in environmental water samples obtained from a slum settlement’, Memórias do Instituto Oswaldo Cruz 105, 353–355.
http://dx.doi.org/10.1590/S0074-02762010000300020 Wang, Q.K., Zhang, J.G., Du, R., Wang, S.Z. & Wilson, P., 1999, ‘Observations of renal histopathology associated with leptospirosis in farmed deer’,
Journal of Jilin Agricultural University 21, 63–65. Yang, C.W., Wu, M.S. & Pan, M.J., 2001, ‘Leptospirosis renal disease’, Nephrology Dialysis Transplantation 16, 73–77.
http://dx.doi.org/10.1093/ndt/16.suppl_5.73 Yener, Z. & Keles, H., 2001, ‘Immunoperoxidase and histopathological examinations of leptospiral nephritis in cattle’, Journal of Veterinary
Medicine Series A 48, 441–447. http://dx.doi.org/10.1046/j.1439-0442.2001.00355.x,
PMid:11599681
|